This work aimed to investigate the possible protective effect of dulaglutide (DLG), a GLP-1 RA, against renal injury induced by HTN via modulating renal VEGF and PPARγ biomarkers.
L-NG-Nitroarginine methyl ester (L-NAME) powder (Sigma Aldrich Co., MO, USA) dissolved in normal saline 0.9% and DLG (1.5 mg in 0.5 mL solution) as Trulicity pre-filled injection pen (Eli Lilly and Company Pharmaceuticals, IN, USA).
This protocol was directed in a unit with the Institutional Animal Care and Use Committee of Cairo University, Egypt (CU-IACUC, code: CU-III-F-14-23). Wistar male rats (200-240 g, 8:10 weeks) were obtained from the National Research Center, Giza, Egypt. Per the ARRIVE guidelines and the European Union directive 2010/63/EU for animal experiments and in line with NIH standards for the Care and Use of Laboratory Animals, this experiment was conducted at the Animal House of the Faculty of Medicine, Cairo University, Giza, Egypt. Rats were allowed to acclimate for 2 weeks before conducting the study in stainless steel cages (six rats/cage). The environment was pathogen-free, naturally ventilated, with regular dark/light cycles. Rat chow and tap water were available ad libitum.
The model rats received L-NAME (50 mg/kg/day,i.p.) [17] for seven weeks. HTN was confirmed after the first week by systolic BP (SBP) above 140 mmHg [18]. Then, we performed a scheduled measure of SBP as described later.
Twenty-four rats were randomly assigned to four groups (n = 6): control group: received daily sterile normal saline 0.9%, s.c. for seven weeks in parallel to the treatment dose; DLG group: rats received daily sterile normal saline 0.9%, s.c. for one week, then DLG (0.2 mg/kg/day,s.c.) for a further 6 weeks [19]; HTN group: HTN was experimentally induced as previously mentioned; HTN+DLG group: received L-NAME and DLG at the formerly assigned duration and doses 1 h apart. The study design and the timeline of administered drugs are illustrated in Fig. 1.
SBP was measured using the non-invasive tail-cuff method (model ML 125 NIBP, ADInstruments Pty. Ltd, Sydney, Australia) [20] at three key intervals: at the beginning of the experiment (to ensure no significant differences among the normotensive rats), after 1 week of L-NAME treatment to confirm the occurrence of HTN, and 2 days before the sacrifice. To minimize potential stress during the measurement, rats underwent a 3-day pre-training period, and all measurements were conducted in a quiet room with dim lighting by a single operator. SBP (cuff deflation pressure) was defined as the point at which the cuff pressure corresponds to restoring the first caudal artery pulse. An average of at least three measurements was recorded for each occasion.
After the last drug doses, rats were individually housed in metabolic cages and deprived of food; however, water was available ad libitum for 24 h [21, 22]. Ice gel bags were wrapped around the collecting tubes to minimize the effects of evaporation. The urinary albumin creatinine ratio (UACR) was calculated using the formula [23]:
After urine collection, rats were anesthetized with 5% isoflurane [24]. Body weights were recorded using a digital scale, then blood samples were collected from the tail vein in plain collection tubes, centrifuged at 3000 rpm at 4 °C for 5 min to obtain sera, and stored at -20 °C. Then, the kidneys from each rat were excised through a midline abdominal incision, washed with chilled phosphate buffer saline (PBS), pH = 7.4, and blotted-dry. Part of the left kidney was kept at -80 °C for RNA extraction; the other part was homogenized with 10% ice-cold PBS, centrifuged for 10 min at 3000 rpm and 4 °C, separated, and stored at -80 °C for biochemical analysis. The right kidney was cut lengthwise and sent for histopathology.
Serum creatinine, urea, urinary creatinine, and albumin levels were assessed by commercially available kits (CR 12 51, UR 21 10, and AB 10 10, respectively, Bio-diagnostics Co., Giza, Egypt) and following the manufacturer's guidelines.
Malondialdehyde (MDA) and glutathione (GSH) were measured spectrophotometrically in the collected supernatant of the tissue homogenate, using available commercial kits (MD 25 2, GR 25 11, respectively, Bio-diagnostics Co., Giza, Egypt) and following the manufacturer's instructions [25, 26].
Commercial ELISA kits for rat interleukin (IL-10) and Tumor necrosis factor-alpha (TNF-α) (E-EL-R0016 and E-EL-R0019, Elabscience, USA) were utilized according to the manufacturer's instructions [27, 28].
Snap-frozen renal tissues were utilized to isolate total mRNA using RNeasy mini kit (74 104, QIAGEN Co., Germany), following the manufacturer's instructions. The concentration and purity of the obtained RNA were investigated by Nanodrop 2000 UV-Vis spectrophotometer (Thermo Fisher Scientific Inc., TX, US). The mRNA was then reverse-transcripted by QuantiTect Rev. Transcription Kit (205311, QIAGEN Co., Germany). Specific primers for PPARγ (Accession No.: NM_013124.3) were designed as follows: [(Forward: 5'CGTGGCCGCAGATTTGAA3') and (Reverse: 5'CTTCCATTACGGAGAGATCCAC3')]. A real-time PCR step was performed using the QuantiTect SYBR green PCR kit (QIAGEN, Germany) using Rotor-Gene Q system, according to the manufacturer's amplification instructions. β actin (Forward: 5'-CATTGCTGACAGGATGCAGAAGG-3') and (Reverse: 5'-TGCTGGAAGGTGGACAGTGAGG-3') was used as housekeeping gene. Results were assessed, and relative quantification was performed using 2-ΔΔCt method [29, 30].
After fixation in NBF 10% for 24 h, renal tissue samples were dehydrated in ascending concentrations of ethanol (70-100%), cleared in xylene, embedded in molten paraffin to obtain blocks, sliced into 4 µm sections, mounted on glass slides, and processed for hematoxylin and eosin (H&E), Periodic Acid Schiff (PAS), picrosirius red, and aldehyde fuchsin staining [31].
Anti-VEGF (cat# VEGF (C-1), sc-7269) and anti-eNOS (cat# NOS3 (A-9): sc-376751) primary antibodies were sourced from SANTA CRUZ BIOTECHNOLOGY, INC (mouse, monoclonal, dilution 1/200). Five-µm-thick paraffin sections were dewaxed in ascending ethanol concentrations. Then, HO was used to clog the endogenous peroxidase. After washing with PBS, sections were incubated with biotinylated rabbit anti-mouse IgG (1/100 dilution) (Vector Labs, VA, USA) for 60 min. The sections were re-washed and left in avidin-biotin-peroxidase complex (Vector Lab. Inc., U.S.A) for another h. 3,3' diaminobenzidine HO was used to evoke the immune reaction. Counterstaining was implemented using hematoxylin. The immune response was distinguished by replacing the primary antibody with PBS as a negative control [32].
All sections were assessed and shot by an expert histologist unaware of the study design, using conventional light microscopy (Carl Zeiss, Jena, Germany) connected to an HD IP camera (5 megapixels). Each image was modified for contrast, brightness, and color balance without picking a particular focus via the MacBook Pro built-in system (macOS, ver.13.5.1), and the authors preserved the original copies. The morphometric measurements and image analysis were performed using ImageJ software v.1.53t; Wayne Rasband and contributors (NIH, USA) in five non-overlapping randomly chosen high-power fields from each slide.
Data were presented as mean ± SD and analyzed employing GraphPad Prism version 8.0.2 (La Jolla, CA, USA). For the intergroup comparison, we used two-way repeated measures ANOVA for analysis of SBP over time across the studied groups and one-way ANOVA for analysis of the biochemical and histological results, followed by Tukey's post-hoc test (p-value < 0.05).