In our study, we first employed single-prolong stress (SPS) as a PTSD model and confirmed the upregulation of autophagy in multiple brain regions of SPS mice in response to stress. Subsequently, autophagy was inhibited by intracerebroventricular administration of 3-Methyladenine (3-MA), a macroautophagic inhibitor. Following 3-MA treatment, anxiety-like behaviors in SPS mice were significantly alleviated. Furthermore, anxiety-like behaviors in SPS mice were alleviated by intracerebroventricular administration of lentivirus-mediated shRNA targeting expression of Atg7 (autophagy-related protein 7), which regulates autophagy. Next, we used the fear-condition (FC) task as another PTSD model, and intracerebroventricular administration of shRNA-Atg7 also facilitated fear extinction in model mice, along with reduced anxiety. Interestingly, microinjection of shRNA-Atg7 into the amygdala, rather than mPFC or hippocampus, had a similar effect on fear extinction. Additionally, Fmr1 knockout (Fmr1 KO) mice, which were previously reported to have disrupted autophagy, were investigated as a potential innate PTSD-resistant mouse model. As expected, Fmr1 KO mice exhibited fewer anxiety-like behaviors following SPS exposure. Finally, we found that local autophagy activation in amygdala reserved the anxiolytic activity in Fmr1 KO mice, which further consolidate our main finding that the upregulation of autophagy in amygdala is essential for PTSD-related anxiety.

Male Wildtype mice (WT, C57BL/6) and Fmr1 KO mice (B6. 129P2-Fmr1tm1Cgr/J, the Jackson Laboratory) were purchased and bred in the animal facility at Wenzhou Medical University. WT and Fmr1 KO mice were 6-8 weeks old at the start of the experiments, unless otherwise specified. A total of 180 WT and 30 Fmr1 KO mice were randomly grouped into NT (No Treatment) or PTSD model and were switched to single housing one week prior to modeling. Mice were maintained on a 12 h:12 h light: dark cycle (lights on at 07:00), at a temperature of 20-22 °C and humidity of 30-60%, with ad libitum access to food and water. On the day of modeling, all mice were placed in the same room. Mice in the PTSD group were treated as described below, while those in NT group mice were not exposed to any stressors. Fmr1 KO mice were genotyped by polymerase chain reaction using the following primers: Fmr1 mutant forward, 5'-CAC GAG ACT AGT GAG ACG TG-3', Wild type forward, 5'-TGT GAT AGA ATA TGC AGC ATG TGA-3', reverse, 5'-CTT CTG GCA CCT CCA GCT T-3'. All animal experiments were conducted with the approval of the Animal Care and Use Committee of Wenzhou Medical University in Wenzhou.

CCGGGCCCGAGTCTGTGAATGTAATCTCGAGATTACATTCACAGACTCGGGCTTTTTG

Atg7 shRNA:

GATCCCCGCAGCTCATTGATAACCATTTCAAGAGAATGGTTATCAATGAGCTGCTTTTTC

In our study, mice were exposed to single-prolonged stress (SPS), a widely used model for PTSD. This procedure is designed to induce persistent PTSD-like symptoms, and includes several severe, systematically different stressors as follows: (1) mice were restrained in 50 ml centrifuge tubes with multiple holes drilled around the tube (air holes were spaced approximately 1 cm apart) for 2 h; (2) After restraint, mice were immediately subjected to a 20-min forced swim in a 2 L beaker (diameter = 14.5 cm) containing 1.2 L water at a depth of 11.7 cm (1.2 L) and a temperature of ~23 °C; (3) Mice were then towel-dried and exposed to ether until they lose consciousness (ether exposure was performed by placing ether-soaked cotton balls in a standard microisolator polycarbonate cage); (4) Finally all mice were housed in new cages with fresh bedding and left undisturbed for seven days to allow PTSD symptoms to develop [13]. The SPS procedure was done between 9 AM and 2 PM. Control mice were not exposed to any stressors.

Experimental procedures were adapted from a previous study with modifications [14]. Generally, in the foot shock paradigm, mice were introduced into fear conditioning chambers (35 cm × 20 cm × 20 cm, Jiliang Tech) and allowed a 5-min adaptation period. A total of 11 intermittent, inescapable electric foot shocks (0.5 mA, 2 s each), each followed by 30 s of 80 dB white noise, were administered. Control groups mice were placed in the same conditioning chambers for an equivalent amount of time but were not subjected to foot shocks or noise. The chambers were wiped clean with 75% ethanol solution between sessions. Three days after foot shock exposure, fear-conditioned mice were reintroduced to the same chambers once daily for 10 days of extinction training. Mice in the control group were also placed in the same chambers for an equivalent amount of time each day. Spontaneous activity was recorded for two and a half minutes during extinction training session. The freezing behavior of mice was measured as an indicator of contextual and auditory fear memory induced by aversive experience. The percentage of cumulative freezing time during spontaneous activity was used to assess the fear responses of mice. Memory recall and extinction were assessed by measuring the freezing time of the first day and the last day of the extinction training sessions, as described in previous studies [14,15,16]. All mice were tested throughout the procedure.

The OFT test was conducted in dim light to assay anxiety-related behavior [17]. Briefly, the mice were placed in a chamber (40 × 40 × 25 cm size), and they were monitored for 5 min of free movement.

In analysis, the center area of the chamber was defined as the 25×25 cm zone in center. The total distance and time spent in the central area were measured using the DigBehv software (Shanghai Jiliang Software Technology Co., Ltd.).

The EPM test was also used in dim light to evaluate anxiety-related behavior [18]. The cross maze is connected by two open arms (35 cm×5 cm) and two closed arms (35 cm×5 cm) and the central area (5 cm×5 cm), with a height of 45 cm. When the test started, mice were released from the center and allowed to explore the maze for 5 min. Time spent in open arms, number of open-arm entries were analyzed using the DigBehv software (Shanghai Jiliang Software Technology Co., Ltd.).

The FST was employed to examine the depressive-like behavior of the mice [19]. In our study, mice were gently released into in a 2 L beaker (diameter = 14.5 cm) with a water depth of about 11.7 cm (1.2 L) at room temperature (about 23 °C). Total immobility time were analyzed by using the DigBehv software (Shanghai Jiliang Software Technology Co., Ltd.). And the stationary time was also timed manually to exclude errors.

The TST is a model of behavioral despair which can reflect depression-like behavior [20]. In the test, mice were suspended by their tail (approximately 1.5 cm from the tip of the tail) with the short-term and inescapable stress. Behavioral tests were always performed between 9AM and 6PM with minimal background noise, immobility time was recorded during a 5-min period, and all the tests were recorded by using the DigBehv software (Shanghai Jiliang Software Technology Co., Ltd.). And the stationary time was also timed manually to exclude errors.

The sucrose preference test can also be designed to detect the depression-like behavior. In this test, mice were placed individually in cages for 48 h, and two bottles (one bottle filled with water and one bottle filled with 1% sucrose) are placed during the adaptation phase. Fasting for food and water for 24 h after adaptation. Water and sucrose consumption were then measured at 12 h, 24 h, 48 h, 72 h. Sucrose preference index = sugar water consumption / (sugar water consumption + pure water consumption).

The protein from mice brain (mPFC, Hippocampus and Amygdala) were extracted by using RIPA buffer containing protease inhibitor cocktail (Beyotime). Lysates were centrifuged at 12,000 rpm for 30 min under the temperature of 4 °C, and then added 5 x loading buffer and denatured at 100 °C for 10 min. Denatured protein was separated by SDS-PAGE (12%) and transferred into polyvinylidene fluoride membranes (ISEQ10100, Millipore). Membranes were blocked with blocking buffer (EpiZyme, Shanghai, China), incubated with primary antibodies at 4 °C overnight. And then the membranes were incubated with secondary antibodies at room temperature for 1 h. Finally, protein bands were developed using ECL (Bio-Rad), and image analysis was conducted using Image J. Data was normalized to GAPDH. The primary antibodies used in this study were as follows: mouse anti-GAPDH (#60004-1-Ig, Proteintech, 1:50,000), rabbit anti-Atg7 (10088-2-AP, Proteintech, 1:1,500), rabbit anti-Beclin-1 (11306-1-AP, Proteintech, 1:1,000), rabbit anti- LC3B (L7543, Sigma, 1:1,000). The secondary antibodies used in this study were as follows: goat anti-mouse IgG-HRP (#SA00001-1, Proteintech, 1:5,000) or goat anti-rabbit IgG-HRP (#SA00001-2, Proteintech, 1:5,000).

Brain tissues were firstly fixed with 4% PFA for 72 h, and then were dehydrated in a 30% sucrose solution for another 72 h, finally they were embedded with Tissue-Tek OCT compound. And then according to the mouse brain atlas, sagittal and coronal sections were cut with a thickness of 20 μm. More than three parallel sections per mouse were used for analyses. For staining of the brain tissue sections, the tissues firstly fixed with 4% PFA for 30 min and then were undertook antigen retrieval for 30 min at 90 °C by sodium citrate antigen retrieval solution (C1032, Solarbio). After antigen retrieval, tissue sections were blocked and permeabilized with 5% BSA (4240GR100, Biofroxx) plus 0.3% Triton X-100 (T8200, Solarbio) for 1 h at room temperature and incubated overnight with primary antibodies at 4 °C. The next day, the tissues were incubated with corresponding secondary antibodies at room temperature for 1 h and finally sealed with DAPI (Solarbio). The primary antibodies used in this study were as follows: rabbit anti-Atg7 (10088-2-AP, Proteintech, 1:200), rabbit anti-Beclin-1 (11306-1-AP, Proteintech, 1:500), mouse anti-c-Fos (66590-1-Ig, Proteintech, 1:200). Secondary antibodies included Donkey anti-rabbit Alexa Fluor488 (A21206, Invitrogen, 1:1,000), Donkey anti-mouse Alexa Fluor488 (A21202, Invitrogen, 1:1,000), Donkey anti-rabbit Alexa Fluor555 (A32732, Invitrogen, 1:1,000), Donkey anti-mouse Alexa Fluor555 (A32773, Invitrogen, 1:1,000). Images were acquired using confocal microscopes (TCS SP8, Leica) or microscope (Li2, Nikon) and analyzed with Image J and Photoshop (Adobe).

For immunofluorescence of mice brain sections, 5um thick sections are baked at 65 °C for 1 h. Then sections are carried out in xylene I-II for 15 min, 100% ethanol I and II for 3 min twice, 95% ethanol for 2 min, followed by 1 min each in 90%, 80%, and 70% ethanol for dewaxing. Antigen retrieval is performed using microwave repair for 5 min or high-pressure repair for 1 min with sodium citrate antigen retrieval solution (C1032, Solarbio, PH 6.0). After washing in PBS and treatment with 3% H2O2, a blocking solution is added and incubated for 30 min at room temperature. Then incubated overnight with primary antibodies at 4 °C. The next day, HRP-conjugated secondary antibodies corresponding to the primary antibody species are added and incubated at 37 °C for 30 min followed by additional PBS washes. Signal amplification is achieved through TSA dilution ranging from 1:100 to 1:1000 and developing for 10 min. The antibody complex is carefully removed using a sodium citrate buffer or a specialized removal buffer/kit. This process is iterated until all labeling is completed, culminating in a final PBS wash and sealed with DAPI (Solarbio). The primary antibodies used in this study were as follows: rabbit anti-Atg7 (10088-2-AP, Proteintech, 1:200), rabbit anti-Beclin-1 (11306-1-AP, Proteintech, 1:500), mouse anti-c-Fos (ab208942, Abcam, 1:200), rabbit anti- LC3B (L7543, Sigma, 1:200).

Male 2-month-old wild-type mice were randomly divided into four groups and then were anesthetized with tribromoethanol (250 mg/kg of body weight, i.p,). After the mouse enters the anesthesia state, the hair on the top of the head was shaved off and fixed to the stereotaxic apparatus. Then cut along the midline, carefully peel off the fascia and rub the surface of the skull with a sterile medical cotton swab dipped in a small amount of hydrogen peroxide until fully exposing the Bregma (anterior fontanelle) point. According to the "Mouse Brain Stereotaxic Atlas", the ICV localization coordinates are selected as anteroposterior (AP) -0.2 mm, mediolateral (ML) + 1 mm (single side, right drilling hole), and dorsoventral (DV) -2.5 mm (the depth of the needle is based on the dura mater). Embed the cannula to 2.5 mm subdural at the selected coordinates. Finally, use dental tray water and dental tray powder to tightly bond the cannula, screws, skull, solidify and loosen the device that holds the cannula, gently remove the PE tube, and insert it into the core of the cannula. After the mice experienced the SPS, 3-MA was given to the ICV on day3-6 through the cannula (with a speed of 2ul/5 min). For the 3-MA groups, 3.7 ug 3-Methyladenine (HY-19312, MCE) dissolved in 0.5 μl saline (ultrasound assisted dissolution) were infused over 5 min and the injector was kept for another 5 min. For other groups, an equal volume of saline was injected.

Intracerebroventricular (ICV) injections: Unilateral intracranial injection of CMVs (OBiO) was performed stereotactically at coordinates posterior 0.2 mm, lateral 1.0 mm, and ventral 2.5 mm relative to the bregma in 2-month-old wild-type mice. 3ul of viral suspension containing 1 × 10 vector genomes (vg) were injected using a 5-μl glass Hamilton syringe with a fixed needle.

Bilateral intracranial injection of CMVs (OBiO) was performed stereotactically at coordinates posterior 1.4 mm, lateral 3.2 mm, and ventral 5.0 mm relative to the bregma in 2-month-old wild-type mice. 1ul per side of viral suspension containing 1 × 10 vector genomes (vg) were injected using a 5-μl glass Hamilton syringe with a fixed needle.

Bilateral intracranial injection of CMVs (OBiO) was performed stereotactically at coordinates anterior 2.0 mm, lateral 0.4 mm, and ventral 2.4 mm relative to the bregma in 2-month-old wild-type mice. 1ul per side of viral suspension containing 1 × 10 vector genomes (vg) were injected using a 5-μl glass Hamilton syringe with a fixed needle.

Bilateral intracranial injection of CMVs (OBiO) was performed stereotactically at coordinates posterior 1.7 mm, lateral 1.8 mm, and ventral 2.0 mm relative to the bregma in 2-month-old wild-type mice. 1ul per side of viral suspension containing 1 × 10 vector genomes (vg) were injected using a 5-μl glass Hamilton syringe with a fixed needle.

Cell RNA was extracted with RNAiso Plus (TRIzol) (T9108, Takara). The concentration of the RNA was determined by UV spectroscopy, then reverse transcribed using TransScript® All-in-One First-Strand cDNA. TransScript® All-in-One First-Strand cDNA Synthesis SuperMix (One-Step gDNA Removal) kit (AT341, TransGen Biotech) was used to reverse transcript 1 g of extracted RNA using UV spectroscopy. With the Real-Time PCR Detection System (CFX96, Bio-Rad), we quantified the expression levels of Atg7 mRNA using TransStart Top Green Supermax (AQ131, TransGen Biotech). The primers used were be listed. For Atg7 primer (Tm = 85.7 °C), forward, 5'-GTTCGCCCTTTAATAGTGC-3'; for GAPDH primer (Tm = 86.9 °C), forward, 5'-ACCCTTAAGAGGGATGCTGC-3' and reverse, 5'-CCCAATACGGCCAAATCCGT-3'. A 20-vl reaction volume was heated at 94 °C for 30 s, followed by 40 cycles of 94 °C for 5 s and 60 °C for 30 s. Multiple changes in gene expression were calculated using the dual-Ct method, using GAPDH as an internal comparator.

"Statistical analyses were conducted using GraphPad Prism version 8.0. The Shapiro-Wilk test was used to assess the normality of the data, and the F-test was used to evaluate variance homogeneity. As the data followed a normal distribution, the student's t-test was used for comparisons between two groups. One-way ANOVA (for single-factor analysis) and two-way ANOVA (for two-factor analysis) were performed with Tukey's post hoc test applied for multiple group comparisons.